Frequently Asked Questions

No. While the recommended storage temperature for a thawed Biolaminin vial is +2°C to +8°C, it can be used at room temperature during handling without affecting functionality. However, we recommend avoiding repeated temperature fluctuations.

Visit our Products page, add the products of interest to the shopping cart, and proceed to checkout. You can also order by sending an email to orders@biolamina.com. Our Application Specialists at sales@biolamina.com will help you in choosing the right product for your needs if in doubt.

We have distributors in selected regions. Please see our distributor list. We ship directly to all other countries.

The frozen Biolaminin stock solution has long-term stability when stored at -20°C to -80°C. For your convenience, you can aliquot the Biolaminin stock solution into smaller aliquots and store it at -30°C-80°C. Repeated freeze/thaw should be avoided. Please refer to the product-specific CoA.

Thawed Biolaminin stock is stable for at least 3 months when stored at +2°C to +8°C under aseptic conditions. Avoid long exposure of the protein to ambient temperatures.

Our data shows that Biolaminin 521 can go through three freeze-thaw cycles without losing functionality. 

Thawed Biolaminin stock solution (100 µg/mL) is stable for at least 3 months when stored at +2°C to +8°C under aseptic conditions. For long-term storage, re-freezing should be done at -30°C to -80°C.

For optimal results, Biolaminin-coated plates should be used as fresh as possible. However, for convenience, coated plates and diluted coating solutions can be stored at 2–8°C for up to 4 weeks.

• Seal the cultureware (e.g., with Parafilm®) to prevent evaporation and contamination.
• Avoid letting the Biolaminin matrix dry, as this will inactivate the coating. If evaporation occurs, adjust the volume by adding DPBS.
• Reusing unused wells from plates stored at 37°C is not recommended.

By following these guidelines, you can ensure consistent performance of your Biolaminin-coated plates.

The proteins should be handled with care and unnecessary exposure of the protein to ambient temperatures should be avoided. If possible, keep the sample on ice during work.

We recommend transferring the cells as single cells (or as small clumps) and always with the addition of ROCKi for the first few (3-5) passages. Once the cells are adapted to the Biolaminin 521 matrix, the cells can be cultured as single cells without ROCKi. This may take up to 5 passages. If the cells are hard to adapt, use a higher coating concentration (10 µg/ml for LN521 or 20 µg/ml for MX521 and CT521) and seed at a higher cell density 50 000–100 000 cells/cm². Once the cells are adapted a lower coating and seeding concentration often can be used.

It is important that the cells transferred to the Biolaminin 521 matrix are of high quality. Biolaminin 521 will generally also support differentiated cells so carefully select only undifferentiated cell areas for transfer.

When changing from feeders, the cells might display a different morphology for the first few passages, likely due to the packed monolayer the cells form when confluent, rather than thick colonies as seen on feeders. It is important that the cells are of high quality when being transferred from feeders to the Biolaminin 521 substrate. Biolaminin 521 supports the maintenance of pluripotent cells but may also support some differentiated cells. Therefore, it is important that only undifferentiated cell colonies are being transferred.

When moving your cells to Biolaminin 521 from another feeder-free matrix (i.e. Matrigel or vitronectin), generally no specific adaptation is needed. We recommend transferring the cells as single cells (or as small clumps) and always with the addition of ROCKi for the first few (3-5) passages. If the cells are hard to adapt, use a higher coating concentration (10 µg/ml for LN521 or 20 µg/ml for MX521 and CT521) and seed at a higher cell density 50 000–100 000 cells/cm². Once the cells are adapted, a lower coating and seeding concentration can often be used.

It is important that the cells transferred to the Biolaminin 521 matrix are of high quality. Biolaminin 521 supports the maintenance of pluripotent cells but may also support some differentiated cells. Therefore, it is important that only undifferentiated cell colonies are being transferred.

Cell morphology should not change much, however, you should be prepared for a different growth pattern. Biolaminin 521 promotes high migration which is vital for cell survival. That will render a more even spread of the cells as compared to feeders and other feeder-free matrices. Also, the cells will likely grow faster.

Yes! Biolaminin 521 successfully recreates the biologically relevant hPSC milieu in vitro, and via integrin binding, Biolaminin 521 induces the PI3K/Akt signaling pathway, promoting high survival and robust long-term self-renewal of human embryonic stem cells (hESC) and induced pluripotent stem cells (iPSC). Due to the biologically relevant support from the laminin matrix, pluripotent stem cells can be cultured as single cells without the need for apoptosis inhibitors, such as ROCKi. When transferred from feeder-cells or feeder-free substrates to Biolaminin, the cells might need an adaptation period. It might take up to 5 passages so give it some time. Once the cells are adapted to the Biolaminin 521 matrix, the cells can be cultured as single cells without ROCKi.

You can use a dissociation reagent of choice (e.g. TrypLE select, Trypsin-EDTA, EDTA, Accutase). The incubation time depends on the solution used to dissociate the cells and the specific cell line. Please note that cells often attach tighter on Biolaminin compared to other matrices and scraping or pipetting without first loosing up cells can affect cell integrity and viability which could result in less attachment the next day. Less confluent cells need shorter treatment time whereas more confluent cells might need longer treatment time. The cells should detach easily without too much pipetting needed. Stem cells are sensitive, and too long exposure to dissociation enzymes or too much mechanical force applied may result in lower cell viability.

The robust support of pluripotent stem cells by the Biolaminin 521 culture substrate allows you to work with your medium and enzyme of choice. As a result, your protocols can easily be made totally defined and animal origin-free. We have successfully tested many different commercial media, such as NutriStem™, mTeSR™1 & TeSR™2, and Essential 8™. However, it is to be expected that cell morphology will look different depending on the medium used for culture.  

If you are using AF Nutristem XF for feeder containing culture, remember to switch to NutriStem XF/FF when using Biolaminin 521 as a coating material.

Many of our customers use the Biolaminin matrix for long-term culture protocols (several months). The Biolaminin coating is functional for at least one month in culture. For long-term culture, if cell detachment is noticed, we recommend adding 5 µg/mL extra laminin to the medium (spiking the medium) to improve attachment.

Yes, Biolaminin 521 supports both single cell and colony passaging. However, we recommend single-cell passage or passage as small clumps since it is a much easier and more reliable method that allows standardized cultures. Each cell will have equal contact with the coating and the medium resulting in a homogenous environment. Biolaminin 521 is the natural niche protein for the cells and enables cell-cell contact since it promotes high cell migration. The survival rate after single-cell seeding is high. When using Biolaminin 521, no treatment with apoptosis inhibitors, such as Rho-kinase (ROCK) inhibitor or blebbistatin, is needed to prevent anoikis. Hence, the conventional method where the colony state is maintained to prevent apoptosis after re-seeding is unnecessary. Single cell passaging also decreases the risk of spontaneous differentiation.

Optimal seeding densities will vary from one cell line to another and should be determined empirically for your system. Biolaminin 521 has been shown to support cell survival of as low as 5,000 cells/cm2. However, we generally recommend seeding your cells at a concentration of 30 000-50 000 cells/cm2 or split your cells with a ratio of 1:10 to 1:30. 

Most cells should have attached within one hour post-seeding and the cells should be evenly distributed over the entire plate. If there’s a lot of cell death after seeding, the cells have most likely been treated too harshly during splitting. After cell attachment, the cell starts to migrate and should have formed small colonies 24h post-seeding. The cells will continue to expand as a homogenous monolayer and are ready to be passaged when cell culture is 60-99% confluent. Depending on the cell line, seeding density, and on the medium used, cultures are usually passaged 3-6 days after seeding.

Clonal cultures can efficiently be done with the Biolaminin 521 under defined and animal origin-free conditions. Biolaminin 521 even allows hESC derivation from a single blastomere without the need to destroy the embryo. The science behind this is further described in an article by Rodin and colleagues (Rodin et al., 2014).

This is probably caused by the high surface tension created in the smaller well formats. Try to slightly increase the coating volume. 

The solutions should be pre-warmed since a large variation in temperature is stressful for the cells.

Yes, most likely. Laminins, as well as many other basal membrane proteins, are highly conserved proteins. Customers working with mouse, sheep, rabbit, and monkey stem cells are successfully using our human recombinant laminins.

No, Biolaminin 511 and 521 supports self-renewal of mouse ES cells in the absence of feeder cells, LIF, or other differentiation inhibitors, even at low cell density. Both laminin isoforms successfully support both naive and primed stem cells since it has been shown to activate the PI3/Akt pathway while the MAPK/ERK pathway is unaffected (Rodin et al., 2014).

The problem could be caused by the following:

1. The coating concentration used is too low for your specific cell line. Try to increase it to 10 μg/ml. Once the cells are adapted to the Biolaminin 521 matrix, you can try to reduce the coating concentration to 5 μg/mL.
2. The coating volume used is not enough. This is often a problem seen with smaller well sizes due to surface tension. For 24-well plates, 500μL of coating solution per well should be enough for even coverage. For a 6-well plate, at least 1ml should be used. 
3. The coating solution has dried out before cell seeding. If the coating matrix goes dry, this will inactivate to coating and it will not support cell growth. This could happen if the coating volume is not sufficient or if the time during the exchange of the coating solution to the culture medium was prolonged. Make sure to seal the plate during overnight coating in the fridge. If a quick coating at 37 degrees is used, do not leave the plate for more than 3 hours to prevent it from drying out.
4. The cells were not seeded evenly in the seeding step. Make sure that you rock the plate side-to-side after seeding to get an even cell spread.
5. The problem might also be in the cultureware plastic. At least Falcon, Sarstedt and Corning tissue culture plates have been tested to work fine for Biolaminin coating.

All our products are defined and animal origin-free (Ref: ISCT guidance document “ISCT Animal-Free Origin Survey Results-Summary”). Please see the diagram below for an explanation of the different levels. You can find links to all the Animal Origin Free statements in the Quality documents page. For more information on the difference between CT, MX, and LN products, please see this Application note.

CTG (Cell Therapy Grade) products are designed for clinical research. More extensive quality control reports are available for CTG than for the MX and LN products. MX and CTG products are animal origin-free to the secondary level, whereas LN products to the primary level. The difference stems from FBS which is used in early seeding phase. Due to dilution effect in the production process, the proportion of serum left in the final product is likely to be very low. Please see this application note for more information and comparison of the three products.

The absorption values for the Biolaminin proteins are displayed in the table below.

In vivo, basement membrane composition is highly cell-surface selective and for proper assembly, laminins are the key proteins. Laminin molecules self-assemble via a thermodynamically unfavorable nucleation binding followed by a calcium-dependent polymerization of the LN domains in the short-arms of the α, β, and γ chains (Yurchenco et al., 1985; Carafoli et al., 2012; Yurchenco & Cheng, 1993; Purvis & Hohenester, 2012). The sheet-like laminin network binds to other proteins in the basement membrane. Laminin interacts with nidogen via LE motifs of the γ1 and γ3 chains (Gersdorff et al., 2005; Takagi et al., 2003; Stetefeld et al., 1996), and the Lβ domain of the β chains binds to agrin (Domogatskaya et al., 2012). Laminin is linked to collagen IV through nidogen and heparin interactions, forming a covalently stabilized network (Hohenester & Yurchenco, 2013). 

Laminins are large proteins with both hydrophobic and hydrophilic sites that allow them to interact with artificial surfaces. The highest density of anionic (negative) charges in laminins is to be found in the LG modules. It has been suggested that the density of negative charges on the surface could be critical for laminin-binding and self-assembly. Tissue-culture treatment is a process by which polystyrene surfaces are made to become hydrophilic, usually by increasing negative charge through a chemical means. This increased negative charge is important for cell attachment and may explain why cells cultured in non-treated plastic ware clump up since they are not attaching adequately to the surface. 

The net charge and isoelectric pH (pI) of the Biolaminin proteins are displayed in the table.

		Protein seq	aa number
Alpha chain	A1	P25391	3075
	A2	P24043	3122
	A3	Q16787	3333
	A4	Q16363	1823
	A5	O15230	3695
Beta chain	B1	P07942	1786
	B2	P55268	1798
	B3	Q13751	1172
Gamma chain	C1	P11047	1609
	C2	Q13753	1193

The LN332 trimeric protein has ~628 kDa total molecular weight (non-reducing SDS-PAGE) and is represented in three individual bands (~367 kDa, 130 kDa, 131 kDa) in reducing SDS-PAGE. We can only be sure that full-length DNA was transfected but since the protein is naturally expressed, we can not be sure whether these two domains are cleaved away or not during protein maturation. Our Biolaminin 332 supports better cell attachment and growth and is thus proved functional. 

The molecular weights (MWs) of the different laminins isoforms are stated in the table below. Due to the complex post-translational modifications such as glycosylation of the laminin molecules, the MWs of each laminin is deduced from amino acid sequences.

Laminin chain	Gene	GenBank accession no.	5’-primer	3’-primer	Amplicon size (bp)	Annealing temp (°C)
α1	LAMA1	NM_005559	GTCAGCGACTCAGAGTGTTTG	AACTTGGGTGAAAGATCGTCAG	185	55
α2	LAMA2	NM_000426	GAACCCGCAGTGTCGAATCT	GGGGAGTTAGCTGCCTTCA	204	55
α3	LAMA3	NM_000227	TAGACTTTGGAAGCACCTACTCA	GTTTATCAAGGACACCACAACCT	185	55
α4	LAMA4	NM_002290	GCAGTGGAAATTCAGATCCCA	TAACCGCAGGTCATCAGTCAG	275	55
α5	LAMA5	NM_005560	GGTGTGTCTCTGCGTGACAA	CCCCGACGTAGAAGACGAA	253	55
β1	LAMB1	NM_002291	AGGAACCCGAGTTCAGCTAC	CACGTCGAGGTCACCGAAA	103	55
β2	LAMB2	NM_002292	GCCCTGGGAACTTCGACTG	GGAAGCACTTCTTTTCGTCCTG	227	55
β3	LAMB3	NM_000228	TCCTCTTGTGTTTTGCCCTG	CTGCCTGGAGTCACACTTG	206	55
γ1	LAMC1	NM_002293	TCGTCAACGCCGCCTTCAA	TACAACAACCAGGCCGACAC	184	55
γ2	LAMC2	NM_005562	CCAGGAGGGAAGTCTGTGATT	GCAGTGAATCCCATCAGTGTT	128	55
γ3	LAMC3	NM_006059	CCAGGTGCATCACATCCTCA	GAC CCCATTTGGGCTCCATT	106	55

γ3 alternative primer pair: 5’-primer: TGACTGGCTGGAAGTGTGAC, 3’-primer: TTGCCTTCCACATTCTCTTT (product size:151 bp)

As a tool to identify and study the expression pattern of different laminin subunits present in a specific tissue, we recommend using the Laminin Marker Panel of PrecisA Monoclonals from Atlas Antibodies.

The α4 and α5 chains of our Biolaminin LN products (i.e. LN521, LN511, LN421, LN411) have a FLAG-tag at the N-terminal end. The α2 chain of LN211 has an HA-tag at the N-terminal end and a FLAG-tag at the C-terminal end. The LN111, LN121, LN221, and LN332 protein products do not contain any tags. Similarly, the Cell Therapy grade Biolaminin 521 (CT521) and the MX521 do not contain tags.

The purity of our Biolaminin products is greater than 95%, as assessed by SDS-PAGE. The laminin protein size is confirmed under the reduced and unreduced conditions and verified equivalently with both methods. 

Our Biolaminin cell culture matrices are the only full-length, recombinant laminins on the market, with all the functional domains intact.

Laminins isolated from tissues are an impure mix of several ECM proteins. Moreover, the proteins are heavily degraded during isolation and lose structural integrity and function. A fractionated or truncated laminin molecule, or undefined laminins isolated from tissues, lacks many of the domains that are needed by the cells to form a proper extracellular matrix network and to stimulate cellular signal transductions. Hence, only the intact, recombinant full-length laminin can create a more authentic and defined cell culture environment.

For reference about the difference in quality and function of commercially available recombinant full laminins versus isolated preparations of laminins, see Wondimu et al., 2006.

Biolaminin substrates are always full laminin proteins.

Basement membranes (BM) are sheet-like extracellular matrix structures that are the foundation for cells to grow on. The BM composition is highly cell-surface selective and laminins are key proteins. In addition to their central role in BM structural organization, laminin is essential for modulation of vital cellular responses, such as cell adhesion, differentiation, migration, phenotype stability, and resistance to apoptosis. Without the right combination of laminin isoforms, cells and tissues become dysfunctional.

Biorelevance is about emphasizing nature. Our laminin cell culture matrices allow you to imitate the natural, cell-specific cell-matrix interaction in vitro, leading to enhanced cell maturation, cell organization, and improved cell functionality. We offer an expansive portfolio of chemically defined and animal origin-free laminin proteins for a variety of applications, including the reliable expansion of pluripotent cell and differentiation and maintenance of specialized cell types, such as hepatocytes, skeletal muscle cells, and different neural cells. The impact of our Biolaminin matrices on cell culture quality has been scientifically validated in many high-quality publications.

1. Prepare the coating solution:
   Dilute the thawed Biolaminin stock solution with 1x DPBS according to the instructions IN-001.
2. Coat the cultureware:
   Add the diluted Biolaminin solution to tissue culture-treated cultureware. Seal the cultureware (e.g., with Parafilm®) to prevent evaporation.
3. Incubation options:
   • Incubate at +2°C to +8°C overnight.
   • For faster coating, incubate at +37°C for 2 hours.
4. Cell culture:
   Before seeding cells, remove the excess coating solution. No washing is required. Add the cell suspension directly to the Biolaminin-coated surface. For general PSC culture guidelines, see Instructions IN-003.
5. Storage of coated plates:
   If not used immediately, store coated plates and any remaining diluted coating solution at +2°C to +8°C for up to 4 weeks.
   Note: Do not let the coated surface dry, as this will inactivate the laminin coating.

Following these steps ensures an optimal environment for your cell culture applications.

The post-thaw cell survival is high when supported by Biolaminin 521, especially when frozen and thawed as single cells. This is nicely described in a publication by Miyazaki and colleagues, where they show that hPSC that were frozen and thawed as colonies showed markedly decreased survival compared to cells frozen and thawed as single cells where the majority of the cells were viable (Miyazaki et al., 2013).

An uneven cell spread is often due to insufficient coating and may result from the following:

1. Insufficient coating concentration

• A concentration that is too low may fail to support even cell growth.
• Solution: Increase the coating concentration until it provides adequate support for uniform cell growth..

2. Poor coating coverage or plate drying

• Ensure the entire surface is evenly covered with the laminin coating solution when preparing fresh plates.
• Avoid letting the plate dry out, as this will inactivate the laminin coating.
• Long incubation times or prolonged storage without proper sealing can lead to evaporation, causing parts of the plate (often the center) to dry out.

By addressing these factors, you can achieve consistent cell spreading and optimal experimental outcomes.

If the transfer from other culture substrates is problematic, please follow the instruction for transfer to Biolaminin. Some of the aspects are listed here:

• We recommend transferring the cells as single cells (or as small clumps) and always with the addition of apoptosis inhibitor, such as ROCKi for the first few (3-5) passages. Once the cells are adapted to the Biolaminin matrix, the cells can be cultured as single cells without ROCKi. This may take up to 5 passages – give it some time.
• If the cells are hard to adapt, try increasing the coating concentration to 10 µg/ml and seed at a higher cell density 50 000–100 000 cells/cm². Once the cells are adapted a lower coating and seeding concentration often can be used.
• It is important that the cells transferred to the Biolaminin matrix are of high quality. Biolaminin 521 also supports specialized cell types so carefully select only undifferentiated cell areas for transfer. 
• Biolaminin 521 works well in combination with most commercial media brands. However, it is to be expected that cell morphology will look different depending on the medium used for culture. 

We usually don’t recommend customers to carry out the coating in less than 2h incubation at 37°C. There is a risk that the coating may not be enough for cell attachment and survival. By increasing the coating concentration above that you usually use could have an effect but the variation that could be caused by this change should be taken into account.

We don’t have any data for this, but to ensure the best coating, one should do a titration to optimize the mix ratio and coating time. 

The Biolaminin coating is functional for at least one month in culture. For long-term culture, if cell detachment occurs, we recommend adding 1-5 µg/mL extra laminin to the medium.

Due to contamination risks and uncontrollable coating concentration issues, we do not recommend re-using the coating solution but rather to evaluate the optimal coating concentration for your cells and application by titration. Often a lower concentration than the recommended starting concentration can be used. For the culture of Biolaminin 521 adapted hESC or iPSC lines, a coating concentration of 5 µg/mL often works well. For many MSC lines and for many neural applications, a coating concentration as low as 1 µg/mL can often be used. Note that the optimal coating concentration is cell type-dependent and should be optimized empirically for specific isoforms and cell lines.

Yes, laminin can be used for coating glass with good cell attachment and maintained cell functions. Coat glassware as you normally coat your cultureware, however, 24-48 hours coating at +2°C to +8°C is recommended for a more reliable coating. Seal the coated glassware to avoid evaporation. Make sure all the surface is completely covered by the laminin coating solution as an uncoated surface will not support cell growth. Please see Miyanari et al., 2013 for coating reference.

Biolaminin protein coating is not optimized for a certain plasticware, but it has been tested to work efficiently on several brands and plate types (e.g. Falcon, Sarstedt, Corning). Biolaminin substrates can even be used to coat glass or bioreactor hollow fibers.

When using the Biosilk 3D culture product, it is important to use a hydrophobic culture plate (e.g. Sarstedt 83.3922.500). Plates that are intended for suspension culture or are non-tissue treated (non-TC) are usually hydrophobic.

No significant difference in cell survival and proliferation rate has been observed.

In-house, we only use cell attachment to estimate coating optimization (not a quantitative method). By seeding the same numbers of cells on the plate that is coated with different amounts of Biolaminin and read the cell confluence next day post-seeding, we can see the optimized coating concentration of the tested cell line. When most cells attach and when the monitored confluence (%) do not increase along with the increased coating concentration the optimal coating concentration has been reached. The optimized coating concentration can be different from cell line to cell line, and we generally recommend using 10 µg/ml as a starting concentration, decreasing the coating concentration to 5 µg/ml once the cells have adapted to the Biolaminin culture conditions.

Another method would be ELISA. A customer of ours has tested an ELISA method where they coated the plate with different amounts of Biolaminin and used an antibody (Abcam ab11575, rabbit polyclonal against mouse EHS) to detect and measure the laminin protein. This antibody recognizes different kinds of laminin chains and could be commonly used for this purpose. However, if more than one type of laminin is used for coating, there are monoclonal antibodies to each laminin chain available from Atlas antibodies.

A too low coating concentration will result in slow growth and an uneven cell spread. Otherwise, no significant impact on cell properties has been observed.

For the culture of hESC or iPSC lines, 10 µg/mL Biolaminin 521 is recommended as a starting concentration. Once the cells have been adapted to the Biolaminin 521 coating, the coating concentration generally can be lowered to 5 µg/mL. The optimal coating concentration is cell type-dependent and should be optimized empirically for specific isoforms and cell lines. For many MSC lines and for many neural applications, a coating concentration as low as 1 µg/mL can often be used. For the culture of some specialized cells, such as cardiomyocytes, a higher coating concentration (10 µg/mL) might be required. A too low coating concentration could result in slow growth or an uneven cell spread.

Biosilk is a natural biomaterial made of recombinant silk protein. Biosilk fibers consist of shorter strings of spider silk protein, spidroins, which contain four poly alanine/glycine-rich blocks and a C-terminal non-repetitive domain. The spidroins are further biofunctionalized with an RGD-domain sequence.

Biosilk 521 is a Biosilk product that is supplemented with recombinant Biolaminin 521 (human recombinant laminin 521 protein). The Biosilk 521 material creates a biologically relevant 3D culture en­vironment for the expansion and differentiation of human pluripotent stem cells. Biosilk can also be supplemented with any other Biolaminin isoform to support the relevant cell type in organoid culture. The Biosilk products can be processed into a variety of two- and three-dimensional formats and integrate into biological systems with excellent biocompatibility.

Biosilk 521 has a Biolaminin 521 concentration of 9 µg/ml. The Biosilk 521 solution is blended as 10 volumes of silk + 1 volume of Biolaminin 521 (10:1).

Biosilk 521 is Biosilk functionalized with Biolaminin 521. Biolaminin 521 (human recombinant laminin 521) is a key cell adhesion protein of the natural stem cell niche, providing the Biosilk 521 material with unique, functional properties that are ideal for integration, proliferation, and subsequent lineage-specific differentiation of human pluripotent stem cells in a 3D format.

Yes, you can mix Biosilk with any Biolaminin product. Add 25 μL of the Biolaminin product of choice to the thawed Biosilk solution (250 μL). Mix by gently pipetting 3 times without introducing air bubbles. The final mixture will have a concentration of 9 µg/mL Biolaminin.

Biolaminin 521 (laminin-521 protein) is a key cell adhesion protein of the natural stem cell niche, expressed and secreted by human pluripotent stem cells (hPSCs) in the inner cell mass of the embryo. The Biolaminin 521 cell culture substrates successfully recreate the biologically relevant hPSC milieu in vitro. Via integrin binding, Biolaminin 521 induces the PI3K/Akt signaling pathway, promoting high survival and robust long-term self-renewal of human embryonic stem cells (hESC) and induced pluripotent stem cells (iPSC). Biolaminin 521 supports the high survival of cells as single cells even without the addition of ROCKi and also promotes migration with facilitates cell organization in the Biosilk scaffold. Together, Biosilk and Biolaminin 521 create a biologically relevant 3D culture environment for the expansion and differentiation of human ES and iPS cells. The laminin 521 protein is also one of the most common laminins expressed in the human adult body and therefore Biolaminin 521 also supports the culture of specialized tissue cell types, such as pancreatic cells, liver cells, vascular cells, cardiac and skeletal muscle cells, and different neural cells.

Contrary to many other 3D scaffolds where the cells are seeded onto an already formed 3D network, cells can be mixed in the Biosilk solution prior to the silk network formation. That means that the newly formed silk fibers will encapsulate the cells and the cells will be evenly distributed throughout the 3D matrix. As a result of the air bubbles present during the formation, this 3D structure will also be porous, allowing for much larger contact with nutrients and oxygen in the media.

No, it is more of a fibrous network than a gel. The Biosilk product is a spider silk-based biomaterial that can be functionalized with various ECM proteins and formed into different 3D structures.

Yes! It’s an excellent 3D culture system for organoid culture. Seed pluripotent stem cells (or another cell type of interest) in Biosilk-Biolaminin foam attached to the bottom of a cell culture well. Amplify the hPSCs to the desired confluency before switching to a differentiation medium of choice. When cells have reached the desired confluency within the microfibrillar network, manually detach the foam from the bottom of the well using a cell scraper or a pipette tip. Cut the foam structure into 2 -4 pieces (approx. 2 mm thick) using a blade or a pair of small scissors and transfer to new low-attachment culture plates for culture as free-floating entities.

It is possible to add a hydrogel to the Biosilk products after assembly (e.g. after generating a foam). However, embedding the organoid in Matrigel is not needed to maintain the organoid shape and cell phenotype. If embedding is preferred, a xenofree and defined material is recommended (e.g. HyStem™ available from Merck).

There are big differences in the spreading and expansion of cells within Biosilk compared to when encapsulating cells in a hydrogel. Biosilk provides a more tissue-like environment that promotes the formation of focal adhesion points that trigger the organization of the cytoskeleton. In a scientific publication from 2019, the authors compared Biosilk to an Alginate hydrogel coupled with the cell-binding motif RGD (0.01-0.04 μmole/mg). Mammalian cells cultured in Biosilk and alginate showed markedly different growth curves. A clear expansion phase was seen for cells integrated into Biosilk, while cells encapsulated in alginate remained at an almost steady metabolic state, an observation is in line with previous reports of the limited proliferation of cells encapsulated in alginate hydrogels. Cells cultured in Biosilk had a more elongated shape (a sign of attachment) and increasingly spread out within the silk scaffold with a clear directional alignment in the fibers. Contrary, cells encapsulated within the hydrogel exhibited a rounded morphology and no spreading was observed (static encapsulation in the hydrogel). In the Biosilk cultures, punctate vinculin-rich focal adhesions sequestered to the tips of cell protrusions were observed, confirming integrin-involved binding of cells to the Biosilk. In the hydrogel, the coupled RGD-motif is available for integrin binding, but the very thin alginate chains (one saccharide unit thick) do not physically allow the gathering of several integrins to the same spot. That prohibits the formation of focal adhesion points which explains the rounded morphology of cells within the alginate gels.

Yes, most proteins will have a tendency to get entrapped/entangled in the Biosilk.

Approximately one to six months. 

The Biosilk products are defined and animal origin-free to the primary level (Ref: ISCT guidance document “ISCT Animal-Free Origin Survey Results-Summary”).

Biosilk with integrated mesenchymal stem cells has a Youngs modulus 1.8 +/− 0.5 MPa with 25% elongation.

When Biosilk or Biosilk 521 is in liquid form, the viscosity is similar to PBS buffer (only 0.3wt% protein).

When the Biosilk products are foamed into a 3D network, it is not possible to measure viscosity, as Biosilk is a porous scaffold, not a gel. However, the stiffness may give an indication of the behavior:  Biosilk with integrated mesenchymal stem cells have a Youngs modulus 1.8 +/−0.5 MPa with 25% elongation. For the same reason, Biosilk does not have a gelation temperature. Biosilk starts to unfold at a temperature of 47°C.

25 kDa

Sheets of Biosilk can be formed by placing a solution of 1 mg/ml still for 8 h (unpublished data).
Films/coatings of Biosilk can be formed by incubating a solution of 0.1-0.3 mg/ml on the preferred surface (e.g. plastic, glass, metal) for 30-60 min and then wash (see Nilebäck et al. 2017).

Yes, but the first foam generated needs to be stabilized at least 20 min before adding the next layer.

Yes, you can expect some autofluorescence, at lower wavelengths, but it is not worse compared to tissue. A couple of collaborators have done calcium imaging with Fluo-4, and it worked really well (published in this scientific article). The best is if you can use fluorophores with an emission wavelength over 350 nm.

Yes! Fix the silk/cell construct in 4% paraformaldehyde, embed them (e.g. Tissue-Tek), and section (e.g. using a Leica cryostat). The procedure is published in this scientific article. Be careful not to let the silk dry (same as with tissue and cells).

Yes, it is possible to enzymatically release (e.g. trypsin, Accutase) cells from the silk form of Biosilk. In the silk form, Biosilk is very stable against proteases.

It is possible to integrate Biosilk into ceramic material and during biomimetic mineralization of calcium phosphate (see upcoming article).

Of course! After seeding and amplification, the cell-foam structure can be detached and lifted off the well to a floating culture for differentiation. 

Make sure a hydrophobic culture plate is being used (e.g. Sarstedt 83.3922.500). If the plate is not hydrophobic, the Biosilk solution will be difficult to pipette and the foam will become flat. Plates that are intended for suspension culture or are non-tissue treated (non-TC) are often hydrophobic.

One vial is enough for 12-13 wells of a 24-wells plate. Smaller volume can be used, eg. 5-10 µl for 96-well plate, but this needs to be tested with all related volume recalculated accordingly i.e. cell suspension, pipet, medium. For a 96-well plate, you need at least 2 vials of Biosilk or Biosilk 521.  

The smallest volume to foam up properly is 4-5 µl but the  small volume is not easy to handle. For 4-5 µl silk, you can add maximal 1 µl cells to the silk. Cell suspension volume radio to silk should exceed 0.25, or the silk will get too diluted and hard to stabilize.

For scale-up, the foam can be cut into smaller pieces of the desired size after the cells have been amplified.

Our current protocol for Biosilk is designed for 24-well plates, and the 96-well plate format has not been tested. A smaller well format is more difficult to work with because foam formation is harder to monitor. If another culture well size is preferred, make sure that the surface is hydrophobic. Plates that are intended for suspension culture or are non-tissue treated (non-TC) are often hydrophobic.

If you want to generate Biosilk or Biosilk 521 foams using a multichannel pipette in 96-well plate (and also add the cells by the multipipette) you will need to have the Biosilk solution and dense cell suspension divided either in multi wells or in some kind of container so that they can be pipetted up with the multi pipette. This all needs a bit of practicing and we would recommend you try with 24 well plate and get a feeling first before scaling up. 

If you want to scale up, you can use a multipipette (tips only in the middle) to generate a larger foam in a hydrophobic 6-well plate. After the cell has amplified to the desired density, the foam can be cut into smaller pieces for further differentiation culture if desired. 

The foam should not touch the well wall because the foam will form in the wrong way. 

No, the cells need to be added to the freshly-foamed foam without delay, or the silk will start polymerizing. Mixing cells into the polymerized foam will interrupt the 3D structure, which might result in the foam breaking apart when the medium is added.

The reason for dispersion could be one of the following:

1. The silk solution has been standing at room temperature too long after thawing. The silk solution should be used directly after thawing (within 1 h). If the solution looks milky, do NOT spin/centrifuge the Biosilk solution as that will damage the product. 

2. The foam is not pipetted well enough. A soggy foam is more difficult to stabilize. Make sure to pipet 22-25 times with rapid speed while spreading the foam to a diameter of 0.7-1.0 cm with circular motions. However, do not over-pipet (more than 25 times) since that could result in a breakdown of the 3D structure formed. Avoid generating too large bubbles because it will give a less fibril structure. During foam formation, try to generate small and evenly distributed bubbles.

3. The ratio of the total added Biolaminin + cell suspension volume to the Biosilk volume used has been higher than 1/5. If the ratio is exceeded, the Biosilk will be too diluted to be able to generate a stable scaffold. If the cells will be mixed in after the foam has been generated, do not use more than 4 µL of the cell suspension to 20 µL of Biosilk or Biosilk 521 solution. If another Biolaminin isoform will be added to the Biosilk, the total added Biolaminin volume should not exceed 1/10 of the Biosilk volume.

4. The stabilization temperature has been lower than 37°C. Try only using the outer wells of the plate so that the stabilization temperature reaches 37°C faster. Alternatively, the stabilization time was not long enough (less than 20 min). Prolong the incubation time to 25 min.

5. When adding the medium to the stabilized foam, carefully drop the medium both on top of the foam and around it. Adding medium only around the foam will have a lifting force to the foam.

There are many things that affect bad foam attachment or poor foam stability:

1. The surface for foam generation is not hydrophobic enough. Culture plates that are intended for suspension culture or are non-tissue treated (non-TC) are usually hydrophobic. We recommend using the plates from SARSTEDT, ref:83.3922.500.

2. The generated foam diameter is too small. If the area size of the foam is too small, that will result in a bigger lifting force once the medium is added. The foam size should be 0.7-1 cm in diameter for good attachment.

3. The silk solution has been standing at room temperature too long after thawing. The silk solution should be used directly after thawing (within 45-60 min). If the solution looks milky, do NOT spin/centrifuge the Biosilk solution as that will damage the product. 

4. The stabilization temperature has been lower than 37°C. Try only using the outer wells of the plate so that the stabilization temperature reaches 37°C faster. Alternatively, the stabilization time was not long enough (less than 20 min). Prolong the incubation time to 25 min.

5. After stabilization, carefully drop the medium both on the foam and around it, before slowly covering the foam with the medium. Filling up medium around the foam only will generate a lifting force to the foam. Do not add the medium too fast as that may break the foam apart.

The air/liquid interface makes the foam stabilize, forming a fibril network around the cells. The air bubbles are not natural in vivo, and the foaming step is just to form the 3D network and the bubbles should disappear. The silk with cells assembles into a thin film around each bubble. The smaller bubbles merge into bigger bubbles that disperse (within 1-4 days) and the foam transforms into a stabilized, multi-layered 3D network with uniformly integrated cells between the microfibers. Mechanical interruption (like puncture) is not recommended. The Biosilk network support cell growth in a 3D environment surrounded with nutrition from all dimensions.