-
What does it mean that the products are animal origin-free to the primary or secondary level?
All our products are defined and animal origin-free (Ref: ISCT guidance document “ISCT Animal-Free Origin Survey Results-Summary”). Please see the […]
-
What is the difference between LN, MX, and CTG Biolaminin products?
CTG (Cell Therapy Grade) products are designed for clinical research. More extensive quality control reports are available for CTG than […]
-
What is the extinction coefficient (absorption) for the different laminin isoforms?
The absorption values for the Biolaminin proteins are displayed in the table below.
-
How do laminin proteins interact with each other and how do they attach to the cell culture well surface?
In vivo, basement membrane composition is highly cell-surface selective and for proper assembly, laminins are the key proteins. Laminin molecules […]
-
What is the amino acid sequence of the different alpha, beta, gamma chains of laminin proteins?
Protein seq aa number Alpha chain A1 P25391 3075 A2 P24043 3122 A3 Q16787 3333 […]
-
Does your Biolaminin 332 product contain the LG4 and LG5 domains of the alpha chain?
The LN332 trimeric protein has ~628 kDa total molecular weight (non-reducing SDS-PAGE) and is represented in three individual bands (~367 […]
-
What are the molecular weights of the different laminin isoforms?
The molecular weights (MWs) of the different laminins isoforms are stated in the table below. Due to the complex post-translational […]
-
Can you provide primer sequences for the laminin chains?
Laminin chain Gene GenBank accession no. 5’-primer 3’-primer Amplicon size (bp) Annealing temp (°C) α1 LAMA1 NM_005559 GTCAGCGACTCAGAGTGTTTG AACTTGGGTGAAAGATCGTCAG 185 […]
-
Which antibodies do you recommend for recognizing different laminin chains in a tissue?
As a tool to identify and study the expression pattern of different laminin subunits present in a specific tissue, we […]
-
Do the recombinant laminins have any purification tag?
The α4 and α5 chains of our Biolaminin LN products (i.e. LN521, LN511, LN421, LN411) have a FLAG-tag at the N-terminal end. […]