Laminin protein information

Laminin nomenclature

Biolaminin productName of the proteinOld synonymsChain compositionGene names of the chains
LN111Laminin-111Laminin-1, EHS lamininα1β1γ1LAMA1, LAMB1, LAMC1
LN121Laminin-121Laminin-3, S-lamininα1β2γ1LAMA1, LAMB2, LAMC1
LN211Laminin-211Laminin-2, Merosinα2β1γ1LAMA2, LAMB1, LAMC1
LN221Laminin-221Laminin-4, S-Merosinα2β2γ1LAMA2, LAMB2, LAMC1
LN332Laminin-332Laminin-5, kalinin,
epiligrin, nicein, ladsin
α3β3γ2LAMA3, LAMB3, LAMC2
LN411Laminin-411Laminin-8α4β1γ1LAMA4, LAMB1, LAMC1
LN421Laminin-421Laminin-9α4β2γ1LAMA4, LAMB2, LAMC1
LN511Laminin-511Laminin-10α5β1γ1LAMA5, LAMB1, LAMC1
LN521, MX521, CT521Laminin-521Laminin-11α5β2γ1LAMA5, LAMB2, LAMC1

Laminin chain primer sequences

A list of primers for the analysis of tissue and cell-specific gene expression of laminin chains.

GenBank accession no.5′ primer3′ primerAmplicon size, bpAnnealing temp, °C
LAMA1  NM_005559GTCAGCGACTCAGAGTGTTTGAACTTGGGTGAAAGATCGTCAG    185     55
LAMA2  NM_000426GAACCCGCAGTGTCGAATCTGGGGAGTTAGCTGCCTTCA    204     55
LAMA3  NM_000227TAGACTTTGGAAGCACCTACTCA     GTTTATCAAGGACACCACAACCT         185     55
LAMA4  NM_002290GCAGTGGAAATTCAGATCCCATAACCGCAGGTCATCAGTCAG    275     55
LAMA5  NM_005560GGTGTGTCTCTGCGTGACAACCCCGACGTAGAAGACGAA    253     55
LAMB1  NM_002291AGGAACCCGAGTTCAGCTACCACGTCGAGGTCACCGAAA    103     55
LAMB2  NM_002292GCCCTGGGAACTTCGACTGGGAAGCACTTCTTTTCGTCCTG    227     55
LAMB3  NM_000228TCCTCTTGTGTTTTGCCCTGCTGCCTGGAGTCACACTTG    206     55
LAMC1  NM_002293TCGTCAACGCCGCCTTCAAGTGTCGGCCTGGTTGTTGTA    184     55
LAMC2  NM_005562CCAGGAGGGAAGTCTGTGATTGCAGTGAATCCCATCAGTGTT    128     55
LAMC3  NM_006059CCAGGTGCATCACATCCTGAGGACCCCATTTGGGCTCCATT    236     55 

GenBank sequence identifiers and annotations

Check your primers using Primer BLAST

Antibodies for human laminin isoforms

Targeting the Biolaminin human recombinant laminin isoforms, a panel of 17 monoclonal mouse antibodies has been developed to selectively recognize each specific subunit of the laminins, without any cross-reactivity to other subunits. The Laminin panel is developed by Atlas Antibodies using the same stringent conditions as for all PrecisA Monoclonals, guaranteeing defined specificity, multiplexing opportunities, secured continuity, and stable supply.

Laminin protein and gene expression in tissues

Study the expression of the laminin genes in different tissues, cell types and pathological states in The Human Protein Atlas.

The Human Protein Atlas is a program that aims to map all the human proteins in cells, tissues and organs using antibody-based imaging, mass spectrometry-based proteomics, transcriptomics and systems biology.

Laminin-beta2 immunohistochemistry (LAMB2 in The Human Protein Atlas)

Laminin protein structure

See protein chain structure predictions in AlphaFold – an AI system developed by DeepMind and EMBL-EBI.

Search PDBe-KB (Protein Data Bank Europe Knowledge Base) for structural and functional protein annotations.